Transcript: Human XM_011523161.3

PREDICTED: Homo sapiens differentially expressed in FDCP 8 homolog (DEF8), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DEF8 (54849)
Length:
1722
CDS:
67..1629

Additional Resources:

NCBI RefSeq record:
XM_011523161.3
NBCI Gene record:
DEF8 (54849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523161.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129263 CCAAGCTGAATACGAACTGAA pLKO.1 837 CDS 100% 4.950 6.930 N DEF8 n/a
2 TRCN0000425593 CACCTGCACAGGGTGTTATTA pLKO_005 753 CDS 100% 15.000 10.500 N DEF8 n/a
3 TRCN0000148418 CAATGAGGATGAGCCAAACAT pLKO.1 627 CDS 100% 5.625 3.938 N DEF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523161.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03468 pDONR223 100% 35.8% 32.4% None (many diffs) n/a
2 ccsbBroad304_03468 pLX_304 0% 35.8% 32.4% V5 (many diffs) n/a
3 TRCN0000471991 CACGAACCGTACTAAAGGATGGAT pLX_317 59.7% 35.8% 32.4% V5 (many diffs) n/a
Download CSV