Transcript: Human XM_011523201.1

PREDICTED: Homo sapiens leucine rich repeat containing 36 (LRRC36), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC36 (55282)
Length:
2021
CDS:
144..1904

Additional Resources:

NCBI RefSeq record:
XM_011523201.1
NBCI Gene record:
LRRC36 (55282)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146913 CCTGTGGAGACTTATTAACTT pLKO.1 763 CDS 100% 5.625 7.875 N LRRC36 n/a
2 TRCN0000128298 GAAGCTTAGTTCAGATCTGTA pLKO.1 821 CDS 100% 4.950 3.960 N LRRC36 n/a
3 TRCN0000128589 GTATCTAATACAGAGCGTCTT pLKO.1 1856 CDS 100% 4.050 3.240 N LRRC36 n/a
4 TRCN0000425275 TCAATGTAGAGCAACAATTAT pLKO_005 880 CDS 100% 15.000 10.500 N LRRC36 n/a
5 TRCN0000433645 CATCGAAGAGAGGATTCAAAT pLKO_005 1048 CDS 100% 13.200 9.240 N LRRC36 n/a
6 TRCN0000415465 AGATCCATCCCTATCAGTTAC pLKO_005 592 CDS 100% 10.800 7.560 N LRRC36 n/a
7 TRCN0000149596 CCCTATCAGTTACCTTCAGAT pLKO.1 600 CDS 100% 4.950 3.465 N LRRC36 n/a
8 TRCN0000129364 GCAGCTGAATAAGGAGCCAAA pLKO.1 1718 CDS 100% 4.050 2.835 N LRRC36 n/a
9 TRCN0000412697 TATAGCATAAAGCCTTCAAAT pLKO_005 717 CDS 100% 13.200 7.920 N LRRC36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08506 pDONR223 100% 77.7% 77.7% None 0_1ins504 n/a
2 ccsbBroad304_08506 pLX_304 0% 77.7% 77.7% V5 0_1ins504 n/a
3 TRCN0000477949 CACCACCCGTAGACATTTTCTGTA pLX_317 12.9% 77.7% 77.7% V5 0_1ins504 n/a
Download CSV