Transcript: Human XM_011523444.1

PREDICTED: Homo sapiens ATPase H+ transporting V0 subunit d1 (ATP6V0D1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP6V0D1 (9114)
Length:
1652
CDS:
319..1143

Additional Resources:

NCBI RefSeq record:
XM_011523444.1
NBCI Gene record:
ATP6V0D1 (9114)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038554 GCACGAGGTAAAGCTGAACAA pLKO.1 975 CDS 100% 4.950 3.960 N ATP6V0D1 n/a
2 TRCN0000333502 GCACGAGGTAAAGCTGAACAA pLKO_005 975 CDS 100% 4.950 3.960 N ATP6V0D1 n/a
3 TRCN0000038555 CCAGCTTCCTAGACTTCATTA pLKO.1 368 CDS 100% 13.200 9.240 N ATP6V0D1 n/a
4 TRCN0000333438 CCAGCTTCCTAGACTTCATTA pLKO_005 368 CDS 100% 13.200 9.240 N ATP6V0D1 n/a
5 TRCN0000038556 CGACAACTACATCCCTATCTT pLKO.1 1119 CDS 100% 5.625 3.938 N ATP6V0D1 n/a
6 TRCN0000333440 CGACAACTACATCCCTATCTT pLKO_005 1119 CDS 100% 5.625 3.938 N ATP6V0D1 n/a
7 TRCN0000038557 CGACTATGAACAGGTCAAGAA pLKO.1 864 CDS 100% 4.950 3.465 N ATP6V0D1 n/a
8 TRCN0000333439 CGACTATGAACAGGTCAAGAA pLKO_005 864 CDS 100% 4.950 3.465 N ATP6V0D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523444.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02083 pDONR223 100% 78% 78% None 0_1ins231 n/a
2 ccsbBroad304_02083 pLX_304 0% 78% 78% V5 0_1ins231 n/a
3 TRCN0000465911 AAACTTCGGATATCTATTGCGGCC pLX_317 40.2% 78% 78% V5 0_1ins231 n/a
Download CSV