Transcript: Human XM_011524044.3

PREDICTED: Homo sapiens growth arrest specific 7 (GAS7), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GAS7 (8522)
Length:
7955
CDS:
159..1397

Additional Resources:

NCBI RefSeq record:
XM_011524044.3
NBCI Gene record:
GAS7 (8522)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524044.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000454956 CGACTACTTCTGGGCTGATAA pLKO_005 569 CDS 100% 13.200 18.480 N GAS7 n/a
2 TRCN0000013226 GCCCAGTCCAAATGGTTTGAA pLKO.1 1143 CDS 100% 5.625 7.875 N GAS7 n/a
3 TRCN0000013223 GCTGCCTAGATCAGTAAATAA pLKO.1 7785 3UTR 100% 15.000 10.500 N GAS7 n/a
4 TRCN0000415162 AGAAGTGCGACCACCACATTG pLKO_005 913 CDS 100% 10.800 7.560 N GAS7 n/a
5 TRCN0000013227 CTTCCGTGAGAACTTCAAGAA pLKO.1 884 CDS 100% 4.950 3.465 N GAS7 n/a
6 TRCN0000013224 GCAAACAAATGCAGAAGGAAA pLKO.1 655 CDS 100% 4.950 3.465 N GAS7 n/a
7 TRCN0000013225 GCGGCATGAAACAGACATGTT pLKO.1 1253 CDS 100% 4.950 3.465 N GAS7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524044.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01948 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01948 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469961 TTAAGACAGGTATCCTCATGTTGT pLX_317 36.8% 100% 100% V5 n/a
Download CSV