Transcript: Human XM_011524180.2

PREDICTED: Homo sapiens solute carrier family 35 member B1 (SLC35B1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC35B1 (10237)
Length:
1453
CDS:
171..938

Additional Resources:

NCBI RefSeq record:
XM_011524180.2
NBCI Gene record:
SLC35B1 (10237)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044407 CCATCATCACTACAACTCGAA pLKO.1 778 CDS 100% 2.640 2.112 N SLC35B1 n/a
2 TRCN0000418919 AGTACCTGTGTGTGCTGTTAA pLKO_005 388 CDS 100% 13.200 9.240 N SLC35B1 n/a
3 TRCN0000435872 GGGTCAGAGCTTCATCTTTAT pLKO_005 725 CDS 100% 13.200 9.240 N SLC35B1 n/a
4 TRCN0000424656 GTTCTTGAGCTTTGCTGAAAG pLKO_005 653 CDS 100% 10.800 7.560 N SLC35B1 n/a
5 TRCN0000434559 TTGGTCTTGATGCCAAGTTTG pLKO_005 889 CDS 100% 10.800 7.560 N SLC35B1 n/a
6 TRCN0000436659 CTGTGATCCTCTTCGCCAATC pLKO_005 820 CDS 100% 6.000 4.200 N SLC35B1 n/a
7 TRCN0000044403 GCCTTAACTTTGGTCTTCATT pLKO.1 148 5UTR 100% 5.625 3.938 N SLC35B1 n/a
8 TRCN0000044404 CATCTATAACATCCTGCTCTT pLKO.1 686 CDS 100% 4.050 2.835 N SLC35B1 n/a
9 TRCN0000044405 CCACATGATGCTGAACATCAA pLKO.1 575 CDS 100% 0.495 0.347 N SLC35B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07573 pDONR223 100% 79% 76% None 0_1ins176;32_33ins25;41G>A n/a
2 ccsbBroad304_07573 pLX_304 0% 79% 76% V5 0_1ins176;32_33ins25;41G>A n/a
3 TRCN0000491328 GCAAGTGCCCTCGACGACCACTAC pLX_317 31% 79% 76% V5 0_1ins176;32_33ins25;41G>A n/a
Download CSV