Transcript: Human XM_011524214.2

PREDICTED: Homo sapiens chondroadherin (CHAD), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHAD (1101)
Length:
2721
CDS:
826..2148

Additional Resources:

NCBI RefSeq record:
XM_011524214.2
NBCI Gene record:
CHAD (1101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219790 CGTGGAGAACCTCGCCAAATT pLKO.1 1647 CDS 100% 13.200 18.480 N CHAD n/a
2 TRCN0000219791 ACGCTGAAACACGTCCATTTG pLKO.1 1873 CDS 100% 10.800 15.120 N CHAD n/a
3 TRCN0000436279 TACTTGTACCTGTCCCATAAC pLKO_005 1375 CDS 100% 10.800 15.120 N CHAD n/a
4 TRCN0000438431 CATGCCGAACCTCGTGTCATT pLKO_005 1287 CDS 100% 4.950 6.930 N CHAD n/a
5 TRCN0000439398 CTCAACCTACAGCGCAACAAC pLKO_005 1234 CDS 100% 4.950 3.465 N CHAD n/a
6 TRCN0000180906 GACAATGCCTTCCAGTCCTTT pLKO.1 1774 CDS 100% 4.950 3.465 N CHAD n/a
7 TRCN0000180471 GCTGGTCAACCTCTTCATCTT pLKO.1 1503 CDS 100% 4.950 3.465 N CHAD n/a
8 TRCN0000178948 CCAAGTCAATCAGAACCACAA pLKO.1 2442 3UTR 100% 4.050 2.835 N CHAD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524214.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00298 pDONR223 100% 81.5% 81.5% None 1_243del n/a
2 ccsbBroad304_00298 pLX_304 0% 81.5% 81.5% V5 1_243del n/a
3 TRCN0000481026 TGCTATGCGCCGCAGGCACGAACC pLX_317 40.5% 81.5% 81.5% V5 1_243del n/a
Download CSV