Transcript: Human XM_011524235.3

PREDICTED: Homo sapiens lysine acetyltransferase 7 (KAT7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KAT7 (11143)
Length:
2588
CDS:
31..1017

Additional Resources:

NCBI RefSeq record:
XM_011524235.3
NBCI Gene record:
KAT7 (11143)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232423 CTGTCACCTGATTGGATATTT pLKO_005 540 CDS 100% 15.000 10.500 N KAT7 n/a
2 TRCN0000232424 GTCATGGTAATAGCATATAAT pLKO_005 1630 3UTR 100% 15.000 10.500 N KAT7 n/a
3 TRCN0000034545 GCCCTTCCTGTTCTATGTTAT pLKO.1 498 CDS 100% 13.200 9.240 N LOC401606 n/a
4 TRCN0000021633 GCTCAAATACTGGAAGGGAAA pLKO.1 873 CDS 100% 4.050 2.835 N KAT7 n/a
5 TRCN0000034547 CATTCTCCATATCCTGAAGAA pLKO.1 235 CDS 100% 4.950 2.970 N LOC401606 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524235.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07760 pDONR223 100% 53.6% 53.6% None 0_1ins849;204T>C n/a
2 ccsbBroad304_07760 pLX_304 0% 53.6% 53.6% V5 0_1ins849;204T>C n/a
3 TRCN0000475389 TATGTTGACTTCCAATGAAAGGCT pLX_317 19.8% 53.6% 53.6% V5 0_1ins849;204T>C n/a
Download CSV