Transcript: Human XM_011524381.2

PREDICTED: Homo sapiens EF-hand calcium binding domain 3 (EFCAB3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFCAB3 (146779)
Length:
1453
CDS:
42..1424

Additional Resources:

NCBI RefSeq record:
XM_011524381.2
NBCI Gene record:
EFCAB3 (146779)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524381.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055439 CCGGTTCAGATAGCCCATATT pLKO.1 799 CDS 100% 13.200 18.480 N EFCAB3 n/a
2 TRCN0000431377 TATCAAGGTTCTAACAGATAA pLKO_005 431 CDS 100% 13.200 18.480 N EFCAB3 n/a
3 TRCN0000055441 CCTACCCAGAAAGTCTATAAT pLKO.1 563 CDS 100% 15.000 10.500 N EFCAB3 n/a
4 TRCN0000055440 CCATTCAAAGACATGCAGAAA pLKO.1 876 CDS 100% 4.950 3.465 N EFCAB3 n/a
5 TRCN0000055442 GCTGGGAATGAATCTGACCAA pLKO.1 341 CDS 100% 2.640 1.848 N EFCAB3 n/a
6 TRCN0000424837 ATCTTCACCATTGATCAAATG pLKO_005 1023 CDS 100% 10.800 6.480 N EFCAB3 n/a
7 TRCN0000055438 GCCAAGAATTACTTTCTCCTA pLKO.1 1261 CDS 100% 2.640 1.320 Y EFCAB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524381.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09633 pDONR223 100% 95.1% 95% None 1_66del;1212G>T n/a
2 ccsbBroad304_09633 pLX_304 0% 95.1% 95% V5 1_66del;1212G>T n/a
3 TRCN0000481376 TGCATCTTACGGGCTCTGCCCGTT pLX_317 32% 95.1% 95% V5 1_66del;1212G>T n/a
Download CSV