Transcript: Human XM_011524611.2

PREDICTED: Homo sapiens apoptosis antagonizing transcription factor (AATF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AATF (26574)
Length:
1990
CDS:
173..1783

Additional Resources:

NCBI RefSeq record:
XM_011524611.2
NBCI Gene record:
AATF (26574)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524611.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274387 TTGACTCAGATCGACCATATT pLKO_005 1349 CDS 100% 13.200 9.240 N AATF n/a
2 TRCN0000017391 CAAGGCACTTAAAGCATTGTT pLKO.1 1009 CDS 100% 5.625 3.938 N AATF n/a
3 TRCN0000285202 CAAGGCACTTAAAGCATTGTT pLKO_005 1009 CDS 100% 5.625 3.938 N AATF n/a
4 TRCN0000285201 ATGGAGGAAACCAGTGACTTT pLKO_005 1840 3UTR 100% 4.950 3.465 N AATF n/a
5 TRCN0000017388 CACTTCAGAAATGGCACGATA pLKO.1 1269 CDS 100% 4.950 3.465 N AATF n/a
6 TRCN0000017389 CGCTCTGTCTATCGAGTTCTT pLKO.1 1412 CDS 100% 4.950 3.465 N AATF n/a
7 TRCN0000017390 GCCAGGGTGATTGACAGGTTT pLKO.1 272 CDS 100% 4.950 3.465 N AATF n/a
8 TRCN0000017392 GCTCTTGGAAGGAAGGATCAA pLKO.1 880 CDS 100% 4.950 3.465 N AATF n/a
9 TRCN0000274386 GCTCTTGGAAGGAAGGATCAA pLKO_005 880 CDS 100% 4.950 3.465 N AATF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524611.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08028 pDONR223 100% 95.6% 95.5% None 5C>T;1546_1547ins72 n/a
2 ccsbBroad304_08028 pLX_304 0% 95.6% 95.5% V5 5C>T;1546_1547ins72 n/a
3 TRCN0000468401 TCCCAACAATTTTAATTGTCCACC pLX_317 19.5% 95.6% 95.5% V5 5C>T;1546_1547ins72 n/a
Download CSV