Transcript: Human XM_011524637.2

PREDICTED: Homo sapiens septin 4 (SEPTIN4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEPTIN4 (5414)
Length:
1878
CDS:
187..1863

Additional Resources:

NCBI RefSeq record:
XM_011524637.2
NBCI Gene record:
SEPTIN4 (5414)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282743 CAGGTCCTTACGGTCCAATTC pLKO_005 935 CDS 100% 10.800 15.120 N n/a
2 TRCN0000263658 TGATGGTGTACACCGAGTTTC pLKO_005 1029 CDS 100% 10.800 15.120 N n/a
3 TRCN0000263657 TGGGTCGTTTAGGAGATAAAT pLKO_005 1796 CDS 100% 15.000 10.500 N n/a
4 TRCN0000282745 GGGTCTGAGGTTACTACTAAC pLKO_005 238 CDS 100% 10.800 7.560 N n/a
5 TRCN0000181109 CCTGAAGAAGCAGAGGAACTT pLKO.1 1830 CDS 100% 4.950 2.970 N n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524637.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09951 pDONR223 100% 96% 94.7% None (many diffs) n/a
2 ccsbBroad304_09951 pLX_304 0% 96% 94.7% V5 (many diffs) n/a
3 TRCN0000465614 CCCGACAGTAGCACTCATTGCTGG pLX_317 21.6% 96% 94.7% V5 (many diffs) n/a
Download CSV