Transcript: Human XM_011524909.2

PREDICTED: Homo sapiens phenylethanolamine N-methyltransferase (PNMT), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PNMT (5409)
Length:
1066
CDS:
426..980

Additional Resources:

NCBI RefSeq record:
XM_011524909.2
NBCI Gene record:
PNMT (5409)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437152 CCAGATCTTGCCAGCTTTCAG pLKO_005 696 CDS 100% 4.950 6.930 N PNMT n/a
2 TRCN0000035590 AGATGATGTCAAGGGCGTCTT pLKO.1 929 CDS 100% 4.050 3.240 N PNMT n/a
3 TRCN0000035591 CCTGGTGCGTAGTGGCTACAA pLKO.1 857 CDS 100% 1.650 1.320 N PNMT n/a
4 TRCN0000035589 GAGGACATCACCATGACAGAT pLKO.1 414 5UTR 100% 4.950 3.465 N PNMT n/a
5 TRCN0000035592 GCACCCTCATCGACATTGGTT pLKO.1 349 5UTR 100% 3.000 2.100 N PNMT n/a
6 TRCN0000035593 GCCCACCTTCAGACAGGCGTA pLKO.1 909 CDS 100% 0.000 0.000 N PNMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524909.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01231 pDONR223 100% 65.2% 65.2% None 0_1ins294 n/a
2 ccsbBroad304_01231 pLX_304 0% 65.2% 65.2% V5 0_1ins294 n/a
3 TRCN0000469437 GACGGCAACTTCGGGAATCACTAG pLX_317 53.3% 65.2% 65.2% V5 0_1ins294 n/a
Download CSV