Transcript: Human XM_011524918.3

PREDICTED: Homo sapiens FAM20A golgi associated secretory pathway pseudokinase (FAM20A), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM20A (54757)
Length:
1854
CDS:
72..1187

Additional Resources:

NCBI RefSeq record:
XM_011524918.3
NBCI Gene record:
FAM20A (54757)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011524918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168142 CATTGACTTTCAGAGACACAA pLKO.1 833 CDS 100% 4.950 3.465 N FAM20A n/a
2 TRCN0000167128 CTTCTTCTACTTCATTGACTT pLKO.1 821 CDS 100% 4.950 3.465 N FAM20A n/a
3 TRCN0000168563 GAGGATAGTAAATGTCACCAA pLKO.1 920 CDS 100% 2.640 1.848 N FAM20A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011524918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10241 pDONR223 100% 59.8% 27.5% None (many diffs) n/a
2 ccsbBroad304_10241 pLX_304 0% 59.8% 27.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000471075 AACATTTGACGGCCCAAGCCAGCC pLX_317 66.7% 59.8% 27.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV