Transcript: Human XM_011525060.2

PREDICTED: Homo sapiens TAO kinase 1 (TAOK1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAOK1 (57551)
Length:
12104
CDS:
217..3222

Additional Resources:

NCBI RefSeq record:
XM_011525060.2
NBCI Gene record:
TAOK1 (57551)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525060.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037524 CCCAAGTATCTCGTCACAAAT pLKO.1 1484 CDS 100% 13.200 18.480 N TAOK1 n/a
2 TRCN0000333379 CCCAAGTATCTCGTCACAAAT pLKO_005 1484 CDS 100% 13.200 18.480 N TAOK1 n/a
3 TRCN0000194926 CGAGAACACTTTGCTACTATA pLKO.1 1519 CDS 100% 13.200 18.480 N TAOK1 n/a
4 TRCN0000037525 CCCAACAGTATAGAATACAAA pLKO.1 472 CDS 100% 5.625 4.500 N TAOK1 n/a
5 TRCN0000333306 CCCAACAGTATAGAATACAAA pLKO_005 472 CDS 100% 5.625 4.500 N TAOK1 n/a
6 TRCN0000037528 CGAGTGTCACTTCACAAATAT pLKO.1 3173 CDS 100% 15.000 10.500 N TAOK1 n/a
7 TRCN0000333380 CGAGTGTCACTTCACAAATAT pLKO_005 3173 CDS 100% 15.000 10.500 N TAOK1 n/a
8 TRCN0000196802 GTCTAATGAATGGTCTGATTA pLKO.1 954 CDS 100% 13.200 9.240 N TAOK1 n/a
9 TRCN0000196941 GCAGCTTAAAGAGGAGCTAAA pLKO.1 1908 CDS 100% 10.800 7.560 N TAOK1 n/a
10 TRCN0000037526 CGCCTCAGATTAGACAAAGAT pLKO.1 1693 CDS 100% 5.625 3.938 N TAOK1 n/a
11 TRCN0000037527 GCCTAAGAGTTTGAAGTCTAA pLKO.1 2349 CDS 100% 4.950 3.465 N TAOK1 n/a
12 TRCN0000363677 GCCTAAGAGTTTGAAGTCTAA pLKO_005 2349 CDS 100% 4.950 3.465 N TAOK1 n/a
13 TRCN0000196451 GCTGAGTGCATATGGTATATT pLKO.1 3326 3UTR 100% 0.000 0.000 N TAOK1 n/a
14 TRCN0000312884 TAATTGGGATGTCATAGTATT pLKO_005 3384 3UTR 100% 13.200 9.240 N Taok1 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 102 5UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 102 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525060.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.