Transcript: Human XM_011525123.2

PREDICTED: Homo sapiens sarcoglycan alpha (SGCA), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGCA (6442)
Length:
1469
CDS:
361..1392

Additional Resources:

NCBI RefSeq record:
XM_011525123.2
NBCI Gene record:
SGCA (6442)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438504 ACATCCCACCTGCTGATTCCA pLKO_005 1310 CDS 100% 3.000 4.200 N SGCA n/a
2 TRCN0000053381 GCTGCCATACCAAGCCGAGTT pLKO.1 915 CDS 100% 1.350 1.890 N SGCA n/a
3 TRCN0000053378 GCCTACAATCGGGACAGCTTT pLKO.1 841 CDS 100% 4.950 3.465 N SGCA n/a
4 TRCN0000436592 ATCGTGGGCTCCAGGTCATTG pLKO_005 812 CDS 100% 3.600 2.520 N SGCA n/a
5 TRCN0000429391 CACTTGTGGGCCGTGTCTTTG pLKO_005 611 CDS 100% 3.600 2.520 N SGCA n/a
6 TRCN0000053382 CATGAGACGTTTCTGAGCCTT pLKO.1 646 CDS 100% 2.640 1.848 N SGCA n/a
7 TRCN0000053379 CCTTCCCATTGAGGGCCGAAA pLKO.1 1080 CDS 100% 1.350 0.945 N SGCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525123.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01526 pDONR223 100% 55.2% 52.5% None (many diffs) n/a
2 ccsbBroad304_01526 pLX_304 0% 55.2% 52.5% V5 (many diffs) n/a
3 TRCN0000478786 TCTGTTATTACTGCCATCTCCATC pLX_317 31% 55.2% 52.5% V5 (many diffs) n/a
Download CSV