Transcript: Human XM_011525353.2

PREDICTED: Homo sapiens transmembrane protein 101 (TMEM101), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM101 (84336)
Length:
4604
CDS:
3265..3864

Additional Resources:

NCBI RefSeq record:
XM_011525353.2
NBCI Gene record:
TMEM101 (84336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282030 CTGGCTGAAGGTCCGTATGTA pLKO_005 3399 CDS 100% 5.625 7.875 N TMEM101 n/a
2 TRCN0000141021 CCAATTGGCCATTAGCACCTA pLKO.1 3342 CDS 100% 2.640 3.696 N TMEM101 n/a
3 TRCN0000275415 CCAATTGGCCATTAGCACCTA pLKO_005 3342 CDS 100% 2.640 3.696 N TMEM101 n/a
4 TRCN0000142402 GCAATGTTGCTTACTGGCACA pLKO.1 3749 CDS 100% 2.160 3.024 N TMEM101 n/a
5 TRCN0000282029 GCAATGTTGCTTACTGGCACA pLKO_005 3749 CDS 100% 2.160 3.024 N TMEM101 n/a
6 TRCN0000142578 GTGTTGAGTTCTGGAACCAGA pLKO.1 3779 CDS 100% 2.640 2.112 N TMEM101 n/a
7 TRCN0000275469 CTGGCCCAGCTGCTGTTTATT pLKO_005 3930 3UTR 100% 15.000 10.500 N TMEM101 n/a
8 TRCN0000141683 CCCAGTGCCTTACCTGTATTT pLKO.1 3240 5UTR 100% 13.200 9.240 N TMEM101 n/a
9 TRCN0000275414 CCCAGTGCCTTACCTGTATTT pLKO_005 3240 5UTR 100% 13.200 9.240 N TMEM101 n/a
10 TRCN0000142047 GCAGTTAAGAGGCAGCTCATT pLKO.1 4003 3UTR 100% 4.950 3.465 N TMEM101 n/a
11 TRCN0000142084 CAGAGGAAGGAAGATGGAGAT pLKO.1 4196 3UTR 100% 4.050 2.835 N TMEM101 n/a
12 TRCN0000141413 CATGCTGCTCATTGATGGCAA pLKO.1 3732 CDS 100% 2.640 1.848 N TMEM101 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525353.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04384 pDONR223 100% 77.4% 77.4% None 0_1ins174 n/a
2 ccsbBroad304_04384 pLX_304 0% 77.4% 77.4% V5 0_1ins174 n/a
3 TRCN0000471909 GTGATAAGTTCAATAAACATACGT pLX_317 63.5% 77.4% 77.4% V5 0_1ins174 n/a
Download CSV