Transcript: Human XM_011525458.2

PREDICTED: Homo sapiens centrosomal protein 95 (CEP95), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP95 (90799)
Length:
1724
CDS:
339..1661

Additional Resources:

NCBI RefSeq record:
XM_011525458.2
NBCI Gene record:
CEP95 (90799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011525458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427493 ATCCGAGCAGCTATTCCTTTA pLKO_005 1107 CDS 100% 10.800 15.120 N CEP95 n/a
2 TRCN0000413498 GGTCAGCTTGTCTCACATAAC pLKO_005 572 CDS 100% 10.800 8.640 N CEP95 n/a
3 TRCN0000418804 ACTGGAGAGCATACGGAATTT pLKO_005 1221 CDS 100% 13.200 9.240 N CEP95 n/a
4 TRCN0000434054 TTAATTTCCAAGTTGCCTAAA pLKO_005 1269 CDS 100% 10.800 7.560 N CEP95 n/a
5 TRCN0000121527 CCATTGCCAATAACCTTCTTT pLKO.1 367 CDS 100% 5.625 3.938 N CEP95 n/a
6 TRCN0000144120 CAGTGAAACATCTCATGAGAA pLKO.1 683 CDS 100% 4.950 3.465 N CEP95 n/a
7 TRCN0000122493 CCTTTGTTGAAGACACGGAAA pLKO.1 1039 CDS 100% 4.050 2.835 N CEP95 n/a
8 TRCN0000144867 GAAAGGGAACTAAGAAGACAT pLKO.1 1649 CDS 100% 4.950 2.970 N CEP95 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011525458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04530 pDONR223 100% 53.5% 46.8% None 1151_1152ins154;1320_1321ins989 n/a
2 ccsbBroad304_04530 pLX_304 0% 53.5% 46.8% V5 1151_1152ins154;1320_1321ins989 n/a
3 TRCN0000469354 CGCTTCCCCGTCCTACGAAGTTAC pLX_317 13.9% 53.5% 46.8% V5 1151_1152ins154;1320_1321ins989 n/a
Download CSV