Transcript: Human XM_011526045.3

PREDICTED: Homo sapiens ring finger protein 125 (RNF125), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF125 (54941)
Length:
1532
CDS:
280..963

Additional Resources:

NCBI RefSeq record:
XM_011526045.3
NBCI Gene record:
RNF125 (54941)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526045.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004230 CCGTTTAATACCCGATGAGAA pLKO.1 798 CDS 100% 4.950 6.930 N RNF125 n/a
2 TRCN0000004233 CTGTCCACTTTGCCGTTTAAT pLKO.1 786 CDS 100% 15.000 10.500 N RNF125 n/a
3 TRCN0000418651 AGTGAAATGAGGGCACATATT pLKO_005 607 CDS 100% 13.200 9.240 N RNF125 n/a
4 TRCN0000004232 GCTTGCTGGATCATTGTATTA pLKO.1 734 CDS 100% 13.200 9.240 N RNF125 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526045.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000467387 TTTAAGAATTCTATTTCCAAAATG pLX_317 66.2% 90.6% 82.8% V5 (many diffs) n/a
2 ccsbBroadEn_14177 pDONR223 99.5% 90.4% 82.4% None (many diffs) n/a
3 ccsbBroad304_14177 pLX_304 0% 90.4% 82.4% V5 (many diffs) n/a
Download CSV