Transcript: Human XM_011526268.3

PREDICTED: Homo sapiens vacuolar protein sorting 4 homolog B (VPS4B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS4B (9525)
Length:
3389
CDS:
237..1493

Additional Resources:

NCBI RefSeq record:
XM_011526268.3
NBCI Gene record:
VPS4B (9525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526268.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230259 GCGATATATGAACGGCATAAA pLKO_005 1859 3UTR 100% 13.200 18.480 N VPS4B n/a
2 TRCN0000257119 GTGAAGCCGCACGTAGAATTA pLKO_005 979 CDS 100% 13.200 18.480 N VPS4B n/a
3 TRCN0000021738 GCTGATCCTAACCATCTTGTA pLKO.1 1347 CDS 100% 4.950 6.930 N VPS4B n/a
4 TRCN0000021737 CCATTGTTATAGAACGACCAA pLKO.1 604 CDS 100% 2.640 3.696 N VPS4B n/a
5 TRCN0000021736 CGAAGATTTGAGAAACGAATT pLKO.1 1104 CDS 100% 0.000 0.000 N VPS4B n/a
6 TRCN0000230257 GGCTGTGATACTGCCTATTAA pLKO_005 680 CDS 100% 15.000 10.500 N VPS4B n/a
7 TRCN0000230258 AGTACAGTCAGCTACTCATTT pLKO_005 1301 CDS 100% 13.200 9.240 N VPS4B n/a
8 TRCN0000218451 GAAGCCAACAACTCAACATTT pLKO_005 804 CDS 100% 13.200 9.240 N VPS4B n/a
9 TRCN0000021735 GCACTGAAAGAGGCTGTGATA pLKO.1 669 CDS 100% 4.950 3.465 N VPS4B n/a
10 TRCN0000021734 GCGGTCACTATCTAACACAAA pLKO.1 1548 3UTR 100% 4.950 3.465 N VPS4B n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2260 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526268.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02185 pDONR223 100% 93.5% 92.7% None (many diffs) n/a
2 TRCN0000479683 ACACCGAGTCGGATATACAAATCC pLX_317 29% 93.5% 92.7% V5 (many diffs) n/a
Download CSV