Transcript: Human XM_011526568.2

PREDICTED: Homo sapiens zinc finger protein 550 (ZNF550), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF550 (162972)
Length:
5806
CDS:
1299..2540

Additional Resources:

NCBI RefSeq record:
XM_011526568.2
NBCI Gene record:
ZNF550 (162972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230243 GCAATAGAGCCCACCTAATTC pLKO_005 2245 CDS 100% 13.200 18.480 N ZNF550 n/a
2 TRCN0000107625 GCTGTCATCAAAGGGTTCTTT pLKO.1 3227 3UTR 100% 5.625 7.875 N ZNF550 n/a
3 TRCN0000107626 CCTTGATTCATGCAGGGACAA pLKO.1 1852 CDS 100% 4.050 3.240 N ZNF550 n/a
4 TRCN0000230241 CCACTTACCCGCCAGTCTTAT pLKO_005 1555 CDS 100% 13.200 9.240 N ZNF550 n/a
5 TRCN0000219119 ATCTTCAACCTCAAGTGATTC pLKO_005 1613 CDS 100% 10.800 7.560 N ZNF550 n/a
6 TRCN0000230244 GATGCAGCTCAGAACTCATAC pLKO_005 2329 CDS 100% 10.800 7.560 N ZNF550 n/a
7 TRCN0000230242 GGGCATTACAAGAGTGGTTAT pLKO_005 1783 CDS 100% 10.800 7.560 N ZNF550 n/a
8 TRCN0000107627 CCACCTAATTCAACATTACAT pLKO.1 2255 CDS 100% 5.625 3.938 N ZNF550 n/a
9 TRCN0000107628 CCCACCTAATTCAACATTACA pLKO.1 2254 CDS 100% 5.625 3.938 N ZNF550 n/a
10 TRCN0000107629 AGGGCATTACAAGAGTGGTTA pLKO.1 1782 CDS 100% 4.950 3.465 N ZNF550 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16114 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_16114 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472999 TCAAGATACCCTTGACCAAATGTT pLX_317 26.3% 100% 100% V5 n/a
4 ccsbBroadEn_13328 pDONR223 100% 99.7% 99.5% None 846A>G;959A>G;1049T>C n/a
5 ccsbBroad304_13328 pLX_304 0% 99.7% 99.5% V5 846A>G;959A>G;1049T>C n/a
6 TRCN0000467044 GCTTAACGGAGGCCGATTATCACG pLX_317 20.8% 99.7% 99.5% V5 846A>G;959A>G;1049T>C n/a
Download CSV