Transcript: Human XM_011526802.2

PREDICTED: Homo sapiens NTPase KAP family P-loop domain containing 1 (NKPD1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NKPD1 (284353)
Length:
6037
CDS:
1979..4477

Additional Resources:

NCBI RefSeq record:
XM_011526802.2
NBCI Gene record:
NKPD1 (284353)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242776 CATGAAGGGCACGGCCGATAA pLKO_005 3499 CDS 100% 3.600 5.040 N NKPD1 n/a
2 TRCN0000242777 TGCCCTTCTCTGTGCCCATTA pLKO_005 3552 CDS 100% 10.800 7.560 N NKPD1 n/a
3 TRCN0000242775 GTTCGTAAGCCAGCGCAAGAA pLKO_005 3187 CDS 100% 4.950 3.465 N NKPD1 n/a
4 TRCN0000242779 CATGACCAAGGCGTTGCAGAA pLKO_005 4087 CDS 100% 4.050 2.835 N NKPD1 n/a
5 TRCN0000242778 GGGTTTCATGTGCGAGGTGAA pLKO_005 3250 CDS 100% 4.050 2.835 N NKPD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526802.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14462 pDONR223 100% 73.1% 50.8% None 1_666del;1908_1910delGCAinsNN n/a
2 ccsbBroad304_14462 pLX_304 0% 73.1% 50.8% V5 (not translated due to prior stop codon) 1_666del;1908_1910delGCAinsNN n/a
3 TRCN0000475284 CAGGAACTCGGGGGAGTCCCCGTC pLX_317 15.6% 73.1% 50.8% V5 (not translated due to prior stop codon) 1_666del;1908_1910delGCAinsNN n/a
Download CSV