Transcript: Human XM_011526884.2

PREDICTED: Homo sapiens hyaluronan synthase 1 (HAS1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HAS1 (3036)
Length:
1513
CDS:
44..1030

Additional Resources:

NCBI RefSeq record:
XM_011526884.2
NBCI Gene record:
HAS1 (3036)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431505 GATACTGGGTAGCCTTCAATG pLKO_005 894 CDS 100% 10.800 15.120 N HAS1 n/a
2 TRCN0000428847 ACGCTGGTCCAAGTCGTACTT pLKO_005 1041 3UTR 100% 4.950 6.930 N HAS1 n/a
3 TRCN0000424286 AGGTCTGTGACTCGGACACAA pLKO_005 744 CDS 100% 4.950 3.465 N HAS1 n/a
4 TRCN0000045383 CAGAGCTACTTCCACTGTGTA pLKO.1 929 CDS 100% 4.950 3.465 N HAS1 n/a
5 TRCN0000045387 CCTCTACATGGTCGACATGTT pLKO.1 466 CDS 100% 0.495 0.347 N HAS1 n/a
6 TRCN0000045386 CCTGCCAAGTTCCTGGCGCTA pLKO.1 1330 3UTR 100% 0.000 0.000 N HAS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526884.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487994 CTGAAGCCCTCGAGTCATAATCTA pLX_317 18.9% 56.4% 51.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV