Transcript: Human XM_011526906.3

PREDICTED: Homo sapiens NCCRP1, F-box associated domain containing (NCCRP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCCRP1 (342897)
Length:
1016
CDS:
20..607

Additional Resources:

NCBI RefSeq record:
XM_011526906.3
NBCI Gene record:
NCCRP1 (342897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526906.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060507 GATGACGAACAACCAGCCATT pLKO.1 533 CDS 100% 4.050 5.670 N NCCRP1 n/a
2 TRCN0000060505 CCCGAAGGCATCAACATTTAT pLKO.1 350 CDS 100% 15.000 10.500 N NCCRP1 n/a
3 TRCN0000060506 CCTGGAAACTCTGGGCAATTT pLKO.1 406 CDS 100% 13.200 9.240 N NCCRP1 n/a
4 TRCN0000060504 GCTGGTACATTAGAACTGAAA pLKO.1 432 CDS 100% 4.950 3.465 N NCCRP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526906.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05483 pDONR223 100% 69.6% 68.3% None (many diffs) n/a
2 ccsbBroad304_05483 pLX_304 0% 69.6% 68.3% V5 (many diffs) n/a
3 TRCN0000476762 CTTCCTGCAACTATTTCTCAGGCG pLX_317 42% 69.6% 68.3% V5 (many diffs) n/a
Download CSV