Transcript: Human XM_011527048.3

PREDICTED: Homo sapiens glutaminyl-peptide cyclotransferase like (QPCTL), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
QPCTL (54814)
Length:
1019
CDS:
305..979

Additional Resources:

NCBI RefSeq record:
XM_011527048.3
NBCI Gene record:
QPCTL (54814)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527048.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222565 CGGGAAATCTCCAAGTCAGAA pLKO.1 633 CDS 100% 4.950 6.930 N QPCTL n/a
2 TRCN0000073955 CCATTATGACTCGAAGCTCTT pLKO.1 805 CDS 100% 4.050 5.670 N QPCTL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527048.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08412 pDONR223 100% 61.1% 44.4% None (many diffs) n/a
2 ccsbBroad304_08412 pLX_304 0% 61.1% 44.4% V5 (many diffs) n/a
3 TRCN0000471299 AACGTCATTCTCGCCCCTCACAAA pLX_317 51.3% 61.1% 44.4% V5 (many diffs) n/a
Download CSV