Transcript: Human XM_011527078.3

PREDICTED: Homo sapiens zinc finger protein 331 (ZNF331), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF331 (55422)
Length:
5164
CDS:
1465..2856

Additional Resources:

NCBI RefSeq record:
XM_011527078.3
NBCI Gene record:
ZNF331 (55422)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428255 AGTAGCCCGCTCGTATCTATG pLKO_005 2873 3UTR 100% 10.800 15.120 N ZNF331 n/a
2 TRCN0000017776 CTAAACCATCTCCGAGAACAT pLKO.1 2815 CDS 100% 4.950 6.930 N ZNF331 n/a
3 TRCN0000017773 CCTCGTTATTCATAAGAGGAT pLKO.1 2067 CDS 100% 2.640 3.696 N ZNF331 n/a
4 TRCN0000017777 CTCGTTAAGCACGAGAGGATA pLKO.1 2488 CDS 100% 0.495 0.693 N ZNF331 n/a
5 TRCN0000413976 TCAATCAGATGATCATCAATT pLKO_005 1763 CDS 100% 13.200 9.240 N ZNF331 n/a
6 TRCN0000416339 ATGGATCGAGCCTCGTGAAAC pLKO_005 2645 CDS 100% 10.800 7.560 N ZNF331 n/a
7 TRCN0000017774 CCTAGAACACATCAGAGACAT pLKO.1 1819 CDS 100% 4.950 3.465 N ZNF331 n/a
8 TRCN0000017775 CGTGGCTATCAACTTAGTCAA pLKO.1 1888 CDS 100% 4.950 3.465 N ZNF331 n/a
9 TRCN0000413864 AGGTGAAAGTTCTCAACTTAA pLKO_005 3272 3UTR 100% 13.200 7.920 N ZNF331 n/a
10 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 3957 3UTR 100% 10.800 5.400 Y MRPS16 n/a
11 TRCN0000152004 CTGGTGAGAAACCTTATGAAT pLKO.1 1925 CDS 100% 5.625 2.813 Y ZNF829 n/a
12 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 3957 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08531 pDONR223 100% 99.8% 99.7% None 175G>A;330A>G n/a
2 ccsbBroad304_08531 pLX_304 0% 99.8% 99.7% V5 175G>A;330A>G n/a
3 TRCN0000480633 GACGCATATTTTCTCCACAGATTG pLX_317 26.4% 99.8% 99.7% V5 175G>A;330A>G n/a
Download CSV