Transcript: Human XM_011527111.3

PREDICTED: Homo sapiens zinc finger protein 302 (ZNF302), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF302 (55900)
Length:
2835
CDS:
214..612

Additional Resources:

NCBI RefSeq record:
XM_011527111.3
NBCI Gene record:
ZNF302 (55900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230177 ATTCATAGATCCTCCCTTATT pLKO_005 2100 3UTR 100% 13.200 9.240 N ZNF302 n/a
2 TRCN0000230175 TATACAGAATGCGACACATTT pLKO_005 828 3UTR 100% 13.200 9.240 N ZNF302 n/a
3 TRCN0000016378 CCCTTCTCATTCAGCATCTAA pLKO.1 1369 3UTR 100% 5.625 3.938 N ZNF302 n/a
4 TRCN0000016379 CCCAACCAGTAACAATGGAAA pLKO.1 757 3UTR 100% 4.950 3.465 N ZNF302 n/a
5 TRCN0000016381 CGACACATTTAGAAGCACCTT pLKO.1 839 3UTR 100% 2.640 1.848 N ZNF302 n/a
6 TRCN0000230176 GTCGTGTGTCCCTTCTCATTC pLKO_005 1360 3UTR 100% 10.800 6.480 N ZNF302 n/a
7 TRCN0000016380 CGGGAGAGAAACCGTATGAAT pLKO.1 1315 3UTR 100% 5.625 3.375 N ZNF302 n/a
8 TRCN0000147098 CCAGCTTGAATCACTGAATAT pLKO.1 1697 3UTR 100% 13.200 6.600 Y ZNF181 n/a
9 TRCN0000016382 CCCTTACACGACATCAGATAA pLKO.1 1204 3UTR 100% 13.200 6.600 Y ZNF302 n/a
10 TRCN0000230174 AGAGTGGGCATGCCTAGATTC pLKO_005 261 CDS 100% 10.800 5.400 Y ZNF302 n/a
11 TRCN0000015520 CTGGAGAGAAGCCTTATGAAT pLKO.1 1483 3UTR 100% 5.625 2.813 Y ZNF625 n/a
12 TRCN0000147181 CCAGACTTGTAATAGAGAGAA pLKO.1 1052 3UTR 100% 4.950 2.475 Y ZNF181 n/a
13 TRCN0000149621 GCTTGCAGTTTCAGTTGAGTT pLKO.1 2657 3UTR 100% 4.950 2.475 Y ZNF181 n/a
14 TRCN0000012945 GCAGTGAATGTGGGAAAGCTT pLKO.1 1084 3UTR 100% 3.000 1.500 Y ZNF146 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03678 pDONR223 100% 28.9% 20% None (many diffs) n/a
2 ccsbBroad304_03678 pLX_304 0% 28.9% 20% V5 (many diffs) n/a
3 TRCN0000465358 CTTACTCGAGAAGCCTAGGAGATG pLX_317 26.9% 28.9% 20% V5 (many diffs) n/a
Download CSV