Transcript: Human XM_011527242.2

PREDICTED: Homo sapiens transforming growth factor beta 1 (TGFB1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TGFB1 (7040)
Length:
1517
CDS:
199..1374

Additional Resources:

NCBI RefSeq record:
XM_011527242.2
NBCI Gene record:
TGFB1 (7040)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003319 CCACAACGAAATCTATGACAA pLKO.1 546 CDS 100% 4.950 3.465 N TGFB1 n/a
2 TRCN0000318448 CCACAACGAAATCTATGACAA pLKO_005 546 CDS 100% 4.950 3.465 N TGFB1 n/a
3 TRCN0000003317 CCCGCGTGCTAATGGTGGAAA pLKO.1 524 CDS 100% 1.650 1.155 N TGFB1 n/a
4 TRCN0000318447 CCCGCGTGCTAATGGTGGAAA pLKO_005 524 CDS 100% 1.650 1.155 N TGFB1 n/a
5 TRCN0000003320 CAAGCAGAGTACACACAGCAT pLKO.1 570 CDS 100% 2.640 1.584 N TGFB1 n/a
6 TRCN0000318388 CAAGCAGAGTACACACAGCAT pLKO_005 570 CDS 100% 2.640 1.584 N TGFB1 n/a
7 TRCN0000003318 CCGGCCTTTCCTGCTTCTCAT pLKO.1 963 CDS 100% 1.650 0.990 N TGFB1 n/a
8 TRCN0000349551 CCGGCCTTTCCTGCTTCTCAT pLKO_005 963 CDS 100% 1.650 0.990 N TGFB1 n/a
9 TRCN0000065993 CGGCAGCTGTACATTGACTTT pLKO.1 1087 CDS 100% 4.950 3.465 N Tgfb1 n/a
10 TRCN0000301506 CGGCAGCTGTACATTGACTTT pLKO_005 1087 CDS 100% 4.950 3.465 N Tgfb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07056 pDONR223 100% 99.6% 99.4% None 29C>T;712_714delGCA n/a
2 ccsbBroad304_07056 pLX_304 17.4% 99.6% 99.4% V5 29C>T;712_714delGCA n/a
3 TRCN0000472904 TTTACCGTTTCTGAGATTACTGCC pLX_317 34.3% 99.6% 99.4% V5 29C>T;712_714delGCA n/a
Download CSV