Transcript: Human XM_011527534.3

PREDICTED: Homo sapiens sialic acid binding Ig like lectin 6 (SIGLEC6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIGLEC6 (946)
Length:
1625
CDS:
156..1532

Additional Resources:

NCBI RefSeq record:
XM_011527534.3
NBCI Gene record:
SIGLEC6 (946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527534.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061984 CCAGCCTCGTACTATGGTTAT pLKO.1 327 CDS 100% 10.800 15.120 N SIGLEC6 n/a
2 TRCN0000061987 CAAATGGATGAAATACGGTTA pLKO.1 530 CDS 100% 4.050 2.835 N SIGLEC6 n/a
3 TRCN0000061985 CCTCTGTGTTTGCTTCATCTT pLKO.1 1271 CDS 100% 4.950 2.970 N SIGLEC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527534.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05960 pDONR223 100% 79.2% 79.7% None 707_787del;1221_1326del;1374_1375ins124 n/a
2 ccsbBroad304_05960 pLX_304 0% 79.2% 79.7% V5 707_787del;1221_1326del;1374_1375ins124 n/a
3 TRCN0000479238 GAATCGGAATACCCGAACCGGAGC pLX_317 26.8% 79.2% 79.7% V5 707_787del;1221_1326del;1374_1375ins124 n/a
Download CSV