Construct: ORF TRCN0000479238
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001063.1_s317c1
- Derived from:
- ccsbBroadEn_05960
- DNA Barcode:
- GAATCGGAATACCCGAACCGGAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SIGLEC6 (946)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479238
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | NM_198845.6 | 99.9% | 100% | 1305A>C |
| 2 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | NM_001245.7 | 96.3% | 96.2% | 707_754del;1353A>C |
| 3 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | XM_011527533.3 | 94.1% | 93.9% | 707_787del;1386A>C |
| 4 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | XM_011527535.3 | 91.7% | 91.5% | 426_427ins33;674_754del;1353A>C |
| 5 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | NM_001177547.3 | 91.6% | 91.7% | 64_65ins108;1197A>C |
| 6 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | XM_011527537.2 | 88.4% | 88.3% | 64_65ins108;599_646del;1245A>C |
| 7 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | XM_011527536.3 | 86.3% | 86.2% | 64_65ins108;599_679del;1278A>C |
| 8 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | XM_011527534.3 | 79.2% | 79.7% | 707_787del;1221_1326del;1374_1375ins124 |
| 9 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | NM_001177548.3 | 78% | 76.2% | 707_787del;1138_1139ins82;1167_1168ins143 |
| 10 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | NM_198846.6 | 74.3% | 69.3% | 707_754del;1012_1013ins176;1059_1060ins124 |
| 11 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | XM_011527538.3 | 72.6% | 67.7% | 707_787del;1045_1046ins176;1092_1093ins124 |
| 12 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | XR_935877.3 | 72.4% | (many diffs) | |
| 13 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | NM_001177549.3 | 71.9% | 67% | (many diffs) |
| 14 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | XM_017027511.2 | 70.8% | 69.5% | (many diffs) |
| 15 | human | 946 | SIGLEC6 | sialic acid binding Ig like... | XM_011527539.3 | 55.8% | 55.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1377
- ORF length:
- 1311
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttgtcatgca gggagcccag gaagcctccg cctcagagat gctaccgctg ctgctgcccc 121 tgctgtgggc aggggccctg gctcaggagc ggagattcca gctggagggg ccagagtcac 181 tgacggtgca ggagggtctg tgcgtcctcg taccctgcag attgcccact acccttccag 241 cctcgtacta tggttatggc tactggttcc tggaaggggc tgatgttcca gtggccacaa 301 acgacccaga cgaagaagtg caggaggaga cccggggccg attccacctc ctctgggatc 361 ccagaaggaa gaactgctcc ctgagcatca gagatgcccg gaggagggac aatgctgcat 421 acttctttcg gttgaagtcc aaatggatga aatacggtta tacatcttcc aagctctctg 481 tgcgtgtgat ggccctgacc cacaggccca acatctccat cccagggacc ctggagtctg 541 gccatcccag caatctgacc tgctctgtgc cctgggtctg tgagcagggg acgcccccca 601 tcttctcctg gatgtcagct gcccccacct ccctgggccc caggaccacc cagtcctcgg 661 tgctcacaat caccccacgg ccccaggacc acagcaccaa cctcacctgt caggtgacgt 721 tccctggagc cggtgtgacc atggagagaa ccatccagct caatgtctcc tccttcaaaa 781 tcctgcaaaa cacctcgtcc ctccctgtcc tggagggcca ggctctgcgg ctgctctgtg 841 atgctgacgg caacccccct gcacacctga gctggttcca gggcttcccc gccctgaacg 901 ccacccccat ctccaatacc ggggtcctgg agctgcctca agtagggtct gcagaagaag 961 gagatttcac ctgccgtgct cagcatcctc tgggctccct gcaaatctct ctgagtctct 1021 ttgtgcattG GAAACCAGAA GGCAGGGCTG GTGGTGTCCT GGGAGCAGTC TGGGGAGCTA 1081 GCATCACAAC CCTGGTTTTC CTCTGTGTTT GCTTCATCTT CAGAGTGAAG ACTAGAAGGA 1141 AGAAAGCAGC CCAGCCAGTG CAAAACACGG ATGATGTGAA CCCCGTCATG GTCTCAGGCT 1201 CCAGGGGTCA TCAGCACCAG TTCCAGACAG GCATAGTTTC AGACCACCCT GCTGAGGCTG 1261 GCCCCATCTC AGAAGATGAG CAGGAGCTCC ACTACGCTGT CCTACACTTC CACAAGGTGC 1321 AACCTCAGGA ACCAAAGGTC ACCGACACTG AGTACTCAGA AATCAAGATC CACAAGTGCC 1381 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 1441 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 1501 ATATATCTTG TGGAAAGGAC GAGAATCGGA ATACCCGAAC CGGAGCACGC GTTAAGTCga 1561 caatcaacct ctggattaca aaatttgtga aagatt