Transcript: Human XM_011527536.3

PREDICTED: Homo sapiens sialic acid binding Ig like lectin 6 (SIGLEC6), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SIGLEC6 (946)
Length:
1801
CDS:
156..1442

Additional Resources:

NCBI RefSeq record:
XM_011527536.3
NBCI Gene record:
SIGLEC6 (946)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061986 CGACACTGAGTACTCAGAAAT pLKO.1 1406 CDS 100% 13.200 9.240 N SIGLEC6 n/a
2 TRCN0000061987 CAAATGGATGAAATACGGTTA pLKO.1 422 CDS 100% 4.050 2.835 N SIGLEC6 n/a
3 TRCN0000061985 CCTCTGTGTTTGCTTCATCTT pLKO.1 1163 CDS 100% 4.950 2.970 N SIGLEC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527536.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479238 GAATCGGAATACCCGAACCGGAGC pLX_317 26.8% 86.3% 86.2% V5 64_65ins108;599_679del;1278A>C n/a
2 ccsbBroadEn_05960 pDONR223 100% 86.3% 85.9% None 64_65ins108;599_679del;1278A>N n/a
3 ccsbBroad304_05960 pLX_304 0% 86.3% 85.9% V5 64_65ins108;599_679del;1278A>N n/a
Download CSV