Transcript: Human XM_011527680.2

PREDICTED: Homo sapiens TNF alpha induced protein 8 like 1 (TNFAIP8L1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFAIP8L1 (126282)
Length:
3784
CDS:
125..685

Additional Resources:

NCBI RefSeq record:
XM_011527680.2
NBCI Gene record:
TNFAIP8L1 (126282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159759 GAAGATGATCTGATTTGGAAA pLKO.1 1161 3UTR 100% 4.950 3.465 N TNFAIP8L1 n/a
2 TRCN0000159560 GATGGAATTAGTTCAGATGAT pLKO.1 1195 3UTR 100% 4.950 3.465 N TNFAIP8L1 n/a
3 TRCN0000165459 GCAGAAGAAGCTCCTGAGTAA pLKO.1 163 CDS 100% 4.950 3.465 N TNFAIP8L1 n/a
4 TRCN0000163157 GCAGCTGTTTCAAACACCAAT pLKO.1 856 3UTR 100% 4.950 3.465 N TNFAIP8L1 n/a
5 TRCN0000165350 GATGCTCAAGAACCTGGTCAA pLKO.1 298 CDS 100% 4.050 2.835 N TNFAIP8L1 n/a
6 TRCN0000165116 CCAGAAGATGCTCAAGAACCT pLKO.1 292 CDS 100% 2.640 1.848 N TNFAIP8L1 n/a
7 TRCN0000159230 CTGATTTGGAAATAGGATCAT pLKO.1 1170 3UTR 100% 4.950 2.970 N TNFAIP8L1 n/a
8 TRCN0000161370 GATTGCTTGAACTCAGAAGTT pLKO.1 1647 3UTR 100% 4.950 2.970 N TNFAIP8L1 n/a
9 TRCN0000165586 GCACACGTATAATCCCAGCTA pLKO.1 2067 3UTR 100% 2.640 1.584 N TNFAIP8L1 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1749 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1749 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1298 3UTR 100% 4.950 2.475 Y ERAP2 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1299 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1747 3UTR 100% 4.950 2.475 Y ERN2 n/a
15 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1747 3UTR 100% 4.950 2.475 Y P3H4 n/a
16 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1747 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1914 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.