Transcript: Human XM_011527796.2

PREDICTED: Homo sapiens adhesion G protein-coupled receptor L1 (ADGRL1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRL1 (22859)
Length:
8006
CDS:
353..4870

Additional Resources:

NCBI RefSeq record:
XM_011527796.2
NBCI Gene record:
ADGRL1 (22859)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011683 GCCGAGATTGAACTTCTCTAT pLKO.1 4436 CDS 100% 4.950 6.930 N ADGRL1 n/a
2 TRCN0000378305 AGAGAACTTGTAAGGATTATA pLKO_005 2202 CDS 100% 15.000 10.500 N ADGRL1 n/a
3 TRCN0000357512 AGGTGTTTGAGAGCGAGTATT pLKO_005 3234 CDS 100% 13.200 9.240 N ADGRL1 n/a
4 TRCN0000378350 AGGTTCCTCCTGCGCTGTAAT pLKO_005 5366 3UTR 100% 13.200 9.240 N ADGRL1 n/a
5 TRCN0000378270 CGCGCAACATCGTCAAGTATG pLKO_005 1041 CDS 100% 10.800 7.560 N ADGRL1 n/a
6 TRCN0000011684 CGGCAACTTCAATAACAGTTA pLKO.1 4180 CDS 100% 4.950 3.465 N ADGRL1 n/a
7 TRCN0000011682 GCTGGTGGTTTAAAGGTTGAA pLKO.1 5444 3UTR 100% 4.950 3.465 N ADGRL1 n/a
8 TRCN0000011685 GCTGTACGTCTGGAACAACTA pLKO.1 1492 CDS 100% 4.950 3.465 N ADGRL1 n/a
9 TRCN0000242208 TCATGTCACAGAGGTGTAATA pLKO_005 624 CDS 100% 13.200 9.240 N Adgrl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488106 TCCCCTTGACCAGATCTTTGAGAA pLX_317 5.1% 97.6% 97.5% V5 (not translated due to prior stop codon) 395_409del;1210_1230del;3683_3754del n/a
Download CSV