Transcript: Human XM_011527923.1

PREDICTED: Homo sapiens C3 and PZP like alpha-2-macroglobulin domain containing 8 (CPAMD8), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPAMD8 (27151)
Length:
5615
CDS:
36..5483

Additional Resources:

NCBI RefSeq record:
XM_011527923.1
NBCI Gene record:
CPAMD8 (27151)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073659 CCCGAAACATGGATTTGGCAT pLKO.1 2418 CDS 100% 2.640 3.696 N CPAMD8 n/a
2 TRCN0000073662 CCGATCAGCATCACCAGGAAT pLKO.1 4813 CDS 100% 4.950 3.960 N CPAMD8 n/a
3 TRCN0000073658 CCTTGCTTACGGAGACACAAA pLKO.1 2846 CDS 100% 4.950 3.960 N CPAMD8 n/a
4 TRCN0000073661 CCATCCTGGATAAAGGGACAA pLKO.1 412 CDS 100% 4.050 2.835 N CPAMD8 n/a
5 TRCN0000073660 CTGGGATGAATTCAGAACATT pLKO.1 3269 CDS 100% 0.000 0.000 N CPAMD8 n/a
6 TRCN0000031932 GAAGACCTTCAAGCCCTTCAT pLKO.1 2573 CDS 100% 4.950 2.970 N Psmb3 n/a
7 TRCN0000287733 GAAGACCTTCAAGCCCTTCAT pLKO_005 2573 CDS 100% 4.950 2.970 N Psmb3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.