Transcript: Human XM_011528051.2

PREDICTED: Homo sapiens theg spermatid protein (THEG), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THEG (51298)
Length:
1898
CDS:
616..1755

Additional Resources:

NCBI RefSeq record:
XM_011528051.2
NBCI Gene record:
THEG (51298)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151453 CGAAGATTCGTGATAACTTCT pLKO.1 1232 CDS 100% 4.950 6.930 N THEG n/a
2 TRCN0000157122 GAGCCCAAGATAAACTGGCAA pLKO.1 1120 CDS 100% 2.640 2.112 N THEG n/a
3 TRCN0000157121 GCACTTTCTGAGTTGGAGAGA pLKO.1 970 CDS 100% 2.640 2.112 N THEG n/a
4 TRCN0000157153 GATCCCAAAGAGGCACTTTCT pLKO.1 958 CDS 100% 4.950 3.465 N THEG n/a
5 TRCN0000157324 CCATGACCAAAGCAAGGAAGA pLKO.1 1067 CDS 100% 4.050 2.835 N THEG n/a
6 TRCN0000156513 GCCCAAGATAAACTGGCAAGT pLKO.1 1122 CDS 100% 4.050 2.835 N THEG n/a
7 TRCN0000157700 CAAGGACTTGGAAGAGGACAT pLKO.1 999 CDS 100% 4.050 2.025 Y THEG n/a
8 TRCN0000157074 GCAAGTCCTGAAAGACAGGAA pLKO.1 1137 CDS 100% 0.264 0.185 N THEG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03273 pDONR223 100% 69.5% 69.5% None 1_108del;535_536ins204;818_913del n/a
2 ccsbBroad304_03273 pLX_304 0% 69.5% 69.5% V5 1_108del;535_536ins204;818_913del n/a
3 TRCN0000469837 ATGAATTGTCTACTAAATAAACTA pLX_317 7.2% 69.5% 69.5% V5 1_108del;535_536ins204;818_913del n/a
Download CSV