Transcript: Human XM_011528164.2

PREDICTED: Homo sapiens RAB3A, member RAS oncogene family (RAB3A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB3A (5864)
Length:
1515
CDS:
167..829

Additional Resources:

NCBI RefSeq record:
XM_011528164.2
NBCI Gene record:
RAB3A (5864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528164.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047953 GACCATCTATCGCAACGACAA pLKO.1 352 CDS 100% 4.050 5.670 N RAB3A n/a
2 TRCN0000380249 GAGAAGATGTCCGAGTCGTTG pLKO_005 719 CDS 100% 4.050 5.670 N RAB3A n/a
3 TRCN0000047957 CGACTCGTTCACGCCTGCCTT pLKO.1 298 CDS 100% 0.000 0.000 N RAB3A n/a
4 TRCN0000047955 ACCAACGAGGAATCCTTCAAT pLKO.1 479 CDS 100% 5.625 3.938 N RAB3A n/a
5 TRCN0000382460 GACCATCACCACCGCATACTA pLKO_005 421 CDS 100% 5.625 3.938 N RAB3A n/a
6 TRCN0000380170 GGTGCTGCTGGTAGGAAACAA pLKO_005 553 CDS 100% 5.625 3.938 N RAB3A n/a
7 TRCN0000382183 ACTGGTCCACCCAGATCAAGA pLKO_005 510 CDS 100% 4.950 3.465 N RAB3A n/a
8 TRCN0000348695 CGCAACGACAAGAGGATCAAG pLKO_005 362 CDS 100% 4.950 3.465 N Rab3a n/a
9 TRCN0000047954 CTACATGTTCAAGATTCTCAT pLKO.1 226 CDS 100% 4.950 3.465 N RAB3A n/a
10 TRCN0000381297 GAAGGAGTCCTCGGATCAGAA pLKO_005 199 CDS 100% 4.950 3.465 N RAB3A n/a
11 TRCN0000381322 TGACCACCTTGGGTTCGAGTT pLKO_005 628 CDS 100% 4.050 2.835 N RAB3A n/a
12 TRCN0000047956 CGAGAAGATGTCCGAGTCGTT pLKO.1 718 CDS 100% 2.640 1.848 N RAB3A n/a
13 TRCN0000382134 TCAAGGTCAAGACCATCTATC pLKO_005 342 CDS 100% 10.800 6.480 N RAB3A n/a
14 TRCN0000375705 GCATCGACTTCAAGGTCAAGA pLKO_005 333 CDS 100% 4.950 2.970 N Rab3d n/a
15 TRCN0000381759 CAACGACAAGAGGATCAAGCT pLKO_005 364 CDS 100% 2.640 1.584 N RAB3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528164.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01358 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01358 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467081 AATGGGAAATGACATTGAAAATTA pLX_317 57.6% 100% 100% V5 n/a
Download CSV