Transcript: Human XM_011528192.2

PREDICTED: Homo sapiens solute carrier family 5 member 5 (SLC5A5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC5A5 (6528)
Length:
4189
CDS:
927..2891

Additional Resources:

NCBI RefSeq record:
XM_011528192.2
NBCI Gene record:
SLC5A5 (6528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043838 CCGCTATACATTCTGGACTTT pLKO.1 1646 CDS 100% 4.950 6.930 N SLC5A5 n/a
2 TRCN0000043842 CACCCAGGAAACTCGTGATTA pLKO.1 2095 CDS 100% 13.200 9.240 N SLC5A5 n/a
3 TRCN0000421646 ATGAGTTCAGGACTACAATAC pLKO_005 3005 3UTR 100% 10.800 7.560 N SLC5A5 n/a
4 TRCN0000043839 CGGATCAACCTCATGGACTTT pLKO.1 1608 CDS 100% 4.950 3.465 N SLC5A5 n/a
5 TRCN0000043840 CCTGGATGACAACTTGGTCAA pLKO.1 2705 CDS 100% 4.050 2.835 N SLC5A5 n/a
6 TRCN0000043841 GCAGTACATTGTAGCCACGAT pLKO.1 1331 CDS 100% 2.640 1.848 N SLC5A5 n/a
7 TRCN0000429957 CAGCATCCACCAGCATCAATG pLKO_005 2020 CDS 100% 10.800 6.480 N SLC5A5 n/a
8 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3383 3UTR 100% 4.950 2.475 Y LOC387873 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 3347 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000156198 CCTCTTGAGTAGCTGGGATTA pLKO.1 3281 3UTR 100% 10.800 5.400 Y MRPL49 n/a
11 TRCN0000276507 CCTCTTGAGTAGCTGGGATTA pLKO_005 3281 3UTR 100% 10.800 5.400 Y MRPL49 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528192.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06960 pDONR223 100% 98.2% 98.3% None 657G>A;966_998del n/a
2 ccsbBroad304_06960 pLX_304 0% 98.2% 98.3% V5 657G>A;966_998del n/a
Download CSV