Transcript: Human XM_011528449.3

PREDICTED: Homo sapiens scaffold attachment factor B2 (SAFB2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAFB2 (9667)
Length:
3242
CDS:
132..2840

Additional Resources:

NCBI RefSeq record:
XM_011528449.3
NBCI Gene record:
SAFB2 (9667)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075057 GACATGAGTGTGCTAGACGAA pLKO.1 519 CDS 100% 2.640 3.696 N SAFB2 n/a
2 TRCN0000075056 CGGCTCAAGAAGGCGGTTAAA pLKO.1 306 CDS 100% 13.200 10.560 N SAFB2 n/a
3 TRCN0000075054 CGGACATTGAAGAATCCCTTT pLKO.1 736 CDS 100% 4.050 3.240 N SAFB2 n/a
4 TRCN0000075053 GCCACCATGTTGTAGCTCAAT pLKO.1 3102 3UTR 100% 4.950 3.465 N SAFB2 n/a
5 TRCN0000075055 GCTACGGATCTCAAGAACCTT pLKO.1 1389 CDS 100% 3.000 2.100 N SAFB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528449.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11398 pDONR223 100% 58.4% 58.4% None 1581G>A;1583A>T;1585_2706del n/a
2 ccsbBroad304_11398 pLX_304 0% 58.4% 58.4% V5 1581G>A;1583A>T;1585_2706del n/a
3 TRCN0000477555 AGGCACCGAATTCAGCAATATTTT pLX_317 26% 58.4% 58.4% V5 1581G>A;1583A>T;1585_2706del n/a
Download CSV