Transcript: Human XM_011528545.1

PREDICTED: Homo sapiens collagen type IX alpha 3 chain (COL9A3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL9A3 (1299)
Length:
1710
CDS:
2..1660

Additional Resources:

NCBI RefSeq record:
XM_011528545.1
NBCI Gene record:
COL9A3 (1299)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116429 TGACCTTCAGTGCCCAAGTAT pLKO.1 511 CDS 100% 5.625 4.500 N COL9A3 n/a
2 TRCN0000116431 CCGGGCAAGGACGGCCAGAAT pLKO.1 908 CDS 100% 0.000 0.000 N COL9A3 n/a
3 TRCN0000377761 CTAAGGGAGACCAGGGTATTG pLKO_005 1311 CDS 100% 10.800 6.480 N COL9A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14592 pDONR223 58.6% 79% 78.2% None (many diffs) n/a
2 ccsbBroad304_14592 pLX_304 0% 79% 78.2% V5 (many diffs) n/a
3 TRCN0000471031 CTCGCCGATCGATCGTCTTCTGCA pLX_317 20.2% 79% 78.2% V5 (many diffs) n/a
Download CSV