Transcript: Human XM_011528567.3

PREDICTED: Homo sapiens CCM2 like scaffold protein (CCM2L), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCM2L (140706)
Length:
2736
CDS:
98..1870

Additional Resources:

NCBI RefSeq record:
XM_011528567.3
NBCI Gene record:
CCM2L (140706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528567.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166548 CGCGACAATGAAGAGCTCATT pLKO.1 443 CDS 100% 0.495 0.396 N CCM2L n/a
2 TRCN0000163004 GACCTCAAACTGACCATACTA pLKO.1 2356 3UTR 100% 5.625 3.938 N CCM2L n/a
3 TRCN0000164850 CCAGATTCTGCTGTGTGACTA pLKO.1 235 CDS 100% 4.950 3.465 N CCM2L n/a
4 TRCN0000166505 CCTGGAGAAAGAGGTCAAGTT pLKO.1 256 CDS 100% 4.950 3.465 N CCM2L n/a
5 TRCN0000417260 CTGTCAGGTCTTCCAGATCAT pLKO_005 1039 CDS 100% 4.950 3.465 N CCM2L n/a
6 TRCN0000166099 GCTTGGAGCAGTTACAGGATT pLKO.1 1308 CDS 100% 4.950 3.465 N CCM2L n/a
7 TRCN0000166504 CACTACACATCCACACCTGAA pLKO.1 1103 CDS 100% 4.050 2.835 N CCM2L n/a
8 TRCN0000165399 CGCAGAAGACAACTACCTGTA pLKO.1 1849 CDS 100% 4.050 2.835 N CCM2L n/a
9 TRCN0000166703 CCAGAGTATTGAGTGTGTGGA pLKO.1 1069 CDS 100% 2.640 1.848 N CCM2L n/a
10 TRCN0000436024 CCTACTGCAACCTGGTCATTC pLKO_005 972 CDS 100% 10.800 7.560 N Ccm2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528567.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14387 pDONR223 100% 25.8% 25.7% None 1_1233del;1381_1458del;1532A>G n/a
2 ccsbBroad304_14387 pLX_304 0% 25.8% 25.7% V5 1_1233del;1381_1458del;1532A>G n/a
3 TRCN0000473762 CCATGGTATTATAGACGTCGGTCT pLX_317 100% 25.8% 25.7% V5 1_1233del;1381_1458del;1532A>G n/a
Download CSV