Transcript: Human XM_011528577.1

PREDICTED: Homo sapiens chromosome 20 open reading frame 173 (C20orf173), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C20orf173 (140873)
Length:
726
CDS:
146..637

Additional Resources:

NCBI RefSeq record:
XM_011528577.1
NBCI Gene record:
C20orf173 (140873)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165482 GCTTGGGAAATTGTGGAGGAA pLKO.1 475 CDS 100% 2.640 1.848 N C20orf173 n/a
2 TRCN0000162952 GAGGAAGCTGTTTAAAGGGAT pLKO.1 490 CDS 100% 2.640 1.584 N C20orf173 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13208 pDONR223 100% 46% 34.2% None (many diffs) n/a
2 ccsbBroad304_13208 pLX_304 0% 46% 34.2% V5 (many diffs) n/a
3 TRCN0000477970 TGATACGCGCCGTTAATCCAATGA pLX_317 85.1% 46% 34.2% V5 (many diffs) n/a
Download CSV