Transcript: Human XM_011528782.2

PREDICTED: Homo sapiens gamma-glutamyltransferase 7 (GGT7), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GGT7 (2686)
Length:
2119
CDS:
225..1511

Additional Resources:

NCBI RefSeq record:
XM_011528782.2
NBCI Gene record:
GGT7 (2686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434331 CAGCAATTACAGCGCCCTTGT pLKO_005 575 CDS 100% 4.050 3.240 N GGT7 n/a
2 TRCN0000420179 ACCTTGAGGAATCAGACTATC pLKO_005 1762 3UTR 100% 10.800 7.560 N GGT7 n/a
3 TRCN0000418129 GAGACCCTGAAGATTGCATTA pLKO_005 750 CDS 100% 10.800 7.560 N GGT7 n/a
4 TRCN0000423225 TGGGACCTGATGACTTCATTG pLKO_005 958 CDS 100% 10.800 7.560 N GGT7 n/a
5 TRCN0000433945 GAGATCCCGTCTATGATTCTA pLKO_005 790 CDS 100% 5.625 3.938 N GGT7 n/a
6 TRCN0000429145 CGTGATGCTGGTACATGACAT pLKO_005 44 5UTR 100% 4.950 3.465 N GGT7 n/a
7 TRCN0000021577 GACGAAATGAGAGCCACCTAA pLKO.1 67 5UTR 100% 4.950 3.465 N GGT7 n/a
8 TRCN0000432029 CTTAGGGATGTGCTTGCAAAC pLKO_005 1827 3UTR 100% 6.000 3.600 N GGT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06271 pDONR223 100% 64.6% 64.6% None 0_1ins702;816C>A n/a
2 ccsbBroad304_06271 pLX_304 0% 64.6% 64.6% V5 0_1ins702;816C>A n/a
3 TRCN0000478008 CCGTACTCACTGTCGTTAAACCCA pLX_317 11.8% 64.6% 64.6% V5 0_1ins702;816C>A n/a
Download CSV