Transcript: Human XM_011528820.2

PREDICTED: Homo sapiens agouti signaling protein (ASIP), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASIP (434)
Length:
765
CDS:
190..588

Additional Resources:

NCBI RefSeq record:
XM_011528820.2
NBCI Gene record:
ASIP (434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083810 TGAACCTACTGGATGTCCCTT pLKO.1 314 CDS 100% 2.640 3.696 N ASIP n/a
2 TRCN0000083811 GAAGGAGGCTTCGATGAAGAA pLKO.1 411 CDS 100% 4.950 3.465 N ASIP n/a
3 TRCN0000083808 GCGCTGAACAAGAAATCCAAA pLKO.1 349 CDS 100% 4.950 3.465 N ASIP n/a
4 TRCN0000083812 GCTGAACAAGAAATCCAAACA pLKO.1 351 CDS 100% 4.950 3.465 N ASIP n/a
5 TRCN0000083809 GATCTTCTAAGAAGGAGGCTT pLKO.1 401 CDS 100% 2.640 1.848 N ASIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528820.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00111 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00111 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471929 GGATATTAACCTTCGAGTTGGTTT pLX_317 78.7% 100% 100% V5 n/a
Download CSV