Transcript: Human XM_011528981.3

PREDICTED: Homo sapiens PDX1 C-terminal inhibiting factor 1 (PCIF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCIF1 (63935)
Length:
2653
CDS:
277..2391

Additional Resources:

NCBI RefSeq record:
XM_011528981.3
NBCI Gene record:
PCIF1 (63935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276215 CGTGGTCTGCATCCGGTATAA pLKO_005 1554 CDS 100% 13.200 18.480 N PCIF1 n/a
2 TRCN0000157332 CGATGTGATTTCGGACCCTTT pLKO.1 516 CDS 100% 4.050 5.670 N PCIF1 n/a
3 TRCN0000156935 GTCCCTACTACTTCAACCGAT pLKO.1 452 CDS 100% 2.640 3.696 N PCIF1 n/a
4 TRCN0000276251 ACGACATTCCTATCAGGTTAT pLKO_005 1082 CDS 100% 10.800 7.560 N PCIF1 n/a
5 TRCN0000158063 CATCCAGACCAATGCTGTCAT pLKO.1 813 CDS 100% 4.950 3.465 N PCIF1 n/a
6 TRCN0000285500 CATCCAGACCAATGCTGTCAT pLKO_005 813 CDS 100% 4.950 3.465 N PCIF1 n/a
7 TRCN0000156618 GATGCCATGGTCTCTCACTTT pLKO.1 1960 CDS 100% 4.950 3.465 N PCIF1 n/a
8 TRCN0000156865 GCAAGGTGGTAGACAAAGGAT pLKO.1 995 CDS 100% 3.000 2.100 N PCIF1 n/a
9 TRCN0000285499 GCAAGGTGGTAGACAAAGGAT pLKO_005 995 CDS 100% 3.000 2.100 N PCIF1 n/a
10 TRCN0000276216 ATATGAAGATTATGGTTCTGC pLKO_005 2487 3UTR 100% 2.640 1.848 N PCIF1 n/a
11 TRCN0000154448 GTGGTCAAATGGAATGTGGAA pLKO.1 1207 CDS 100% 2.640 1.848 N PCIF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528981.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.