Transcript: Human XM_011528991.1

PREDICTED: Homo sapiens N-terminal EF-hand calcium binding protein 3 (NECAB3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NECAB3 (63941)
Length:
1563
CDS:
216..821

Additional Resources:

NCBI RefSeq record:
XM_011528991.1
NBCI Gene record:
NECAB3 (63941)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054078 GCTGCTTGCTTTCTATTTATT pLKO.1 972 3UTR 100% 15.000 10.500 N NECAB3 n/a
2 TRCN0000443720 TTCAGCCTCCAAGCTACTTTG pLKO_005 1030 3UTR 100% 10.800 7.560 N NECAB3 n/a
3 TRCN0000054080 GCCTCCAAAGTGGACCAGTTT pLKO.1 101 5UTR 100% 4.950 3.465 N NECAB3 n/a
4 TRCN0000441323 GGTGGATAATGAATAACAACT pLKO_005 799 CDS 100% 4.950 3.465 N NECAB3 n/a
5 TRCN0000054081 CTGTATGAGTTCTGGCAGGAT pLKO.1 663 CDS 100% 2.640 1.848 N NECAB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14241 pDONR223 100% 53.8% 6.1% None (many diffs) n/a
2 ccsbBroad304_14241 pLX_304 0% 53.8% 6.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481233 CCATCTCGTGTCTATCCTCCGCCG pLX_317 35.6% 53.8% 6.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV