Construct: ORF TRCN0000481233
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003335.2_s317c1
- Derived from:
- ccsbBroadEn_14241
- DNA Barcode:
- CCATCTCGTGTCTATCCTCCGCCG
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- NECAB3 (63941)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481233
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 63941 | NECAB3 | N-terminal EF-hand calcium ... | NM_031231.4 | 99.2% | 7.7% | 12delG;48_53delGCCCCA;845T>C |
| 2 | human | 63941 | NECAB3 | N-terminal EF-hand calcium ... | XM_005260510.1 | 94.2% | 8.1% | (many diffs) |
| 3 | human | 63941 | NECAB3 | N-terminal EF-hand calcium ... | NM_031232.4 | 90.7% | 7% | (many diffs) |
| 4 | human | 63941 | NECAB3 | N-terminal EF-hand calcium ... | XM_011528991.1 | 53.8% | 6.1% | (many diffs) |
| 5 | human | 63941 | NECAB3 | N-terminal EF-hand calcium ... | XM_017028015.1 | 53.8% | 6.1% | (many diffs) |
| 6 | human | 63941 | NECAB3 | N-terminal EF-hand calcium ... | XM_017028016.1 | 53.8% | 6.1% | (many diffs) |
| 7 | human | 63941 | NECAB3 | N-terminal EF-hand calcium ... | XM_011528992.2 | 49.5% | 15.2% | (many diffs) |
| 8 | human | 63941 | NECAB3 | N-terminal EF-hand calcium ... | XR_002958502.1 | 40.3% | (many diffs) | |
| 9 | mouse | 56846 | Necab3 | N-terminal EF-hand calcium ... | NM_021546.3 | 84.3% | 7.6% | (many diffs) |
| 10 | mouse | 56846 | Necab3 | N-terminal EF-hand calcium ... | XM_030251901.1 | 81.6% | 7.3% | (many diffs) |
| 11 | mouse | 56846 | Necab3 | N-terminal EF-hand calcium ... | XM_011239713.1 | 65% | 5.7% | (many diffs) |
| 12 | mouse | 56846 | Necab3 | N-terminal EF-hand calcium ... | XM_011239712.1 | 63.2% | 5.5% | (many diffs) |
| 13 | mouse | 56846 | Necab3 | N-terminal EF-hand calcium ... | XR_001783157.1 | 33.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 327
- ORF length:
- 261
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtgcgcgggc tgctcaccgt gtgcctgctc cggccgcccg cgccccagcc 121 ccagaccccg cggcaccccc agctcgcgcc cgacccgggg cccgccggac acacgctctt 181 ccaggacgtt ttccgcagag cagacaagaa tgatgatggg aagctctcat ttgaggaatt 241 ccagaattac tttgccgatg gggttctcag cctgggggag ctgcaggaac tgttcagcgg 301 cattgatggg catctcaccg acaatttaga aacagaaaaa ctgtgtgact acttctcaga 361 gcacctgggt gtctaccggc cggtgctggc tgcattggaa tcgctgaacc gtgcagtgct 421 cgctgccatg gatgccacca agctggagta cgagagggcc tccaaagtgg accagtttgt 481 gacgcgcttc ctgctgcggg agacggtgag ccagctgcaa gcccttcaga gctcgctgga 541 gggggcgtca gataccctgg aggcccaggc ccatggctgg cggtcagatg cagagagcgt 601 ggaggcgcag agcaggctct gcggcagccg gcgggcagga cgccgagccc tgaggagtgt 661 cagccggtca tccacctggt cccccggctc ttctgacaca gggcgcagct cagaggccga 721 gatgcagtgg cggctccagg tgaaccgcct ccaggagctc atcGACCAGC TCGAGTGCAA 781 GGCCCCCCGG CTGGAACCCC TGCGTGAAGA GGACCTGGCC AAGGGGCCTG ACTTGCACAT 841 CCTCATGGCC CAGAGGCAGG TCCAGGTGGC AGAGGAAGGC CTGCAGGACT TCCACCGAGC 901 CCCGCGCTGC TATGTGGACT TCACAGGGGC CCAGAGCCAT TGTCTGCATG TGTCCGCCCA 961 GAAGATGCTG GACGGTGCCT CCTTCACCCT GTATGAGTTC TGGCAGGATG AGGCCTCCTG 1021 GAGAAGGCAC CAGCAGTCGC CTGGCAGCAA GGCCTTCCAG CGCATCCTCA TCGACCACCT 1081 GCGGGCCCCG GACACCCTCA CCACTGTGTT CTTCCCAGCC TCCTGGTGGA TAATGAATAA 1141 CAACTGCCCA GCTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT 1201 CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC 1261 TTGGCTTTAT ATATCTTGTG GAAAGGACGA CCATCTCGTG TCTATCCTCC GCCGACGCGT 1321 TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt