Transcript: Human XM_011528992.2

PREDICTED: Homo sapiens N-terminal EF-hand calcium binding protein 3 (NECAB3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NECAB3 (63941)
Length:
725
CDS:
77..631

Additional Resources:

NCBI RefSeq record:
XM_011528992.2
NBCI Gene record:
NECAB3 (63941)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054079 CCGACAATTTAGAAACAGAAA pLKO.1 336 CDS 100% 4.950 6.930 N NECAB3 n/a
2 TRCN0000442564 AGGAACTGTTCAGCGGCATTG pLKO_005 303 CDS 100% 6.000 4.800 N NECAB3 n/a
3 TRCN0000054080 GCCTCCAAAGTGGACCAGTTT pLKO.1 476 CDS 100% 4.950 3.465 N NECAB3 n/a
4 TRCN0000054082 CGCAGAGCAGACAAGAATGAT pLKO.1 212 CDS 100% 5.625 3.375 N NECAB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14241 pDONR223 100% 49.5% 15.2% None (many diffs) n/a
2 ccsbBroad304_14241 pLX_304 0% 49.5% 15.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481233 CCATCTCGTGTCTATCCTCCGCCG pLX_317 35.6% 49.5% 15.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV