Transcript: Human XM_011529258.2

PREDICTED: Homo sapiens Ras and Rab interactor 2 (RIN2), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIN2 (54453)
Length:
4385
CDS:
178..2865

Additional Resources:

NCBI RefSeq record:
XM_011529258.2
NBCI Gene record:
RIN2 (54453)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529258.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062645 GCAGGGATGTTCTACCATTTA pLKO.1 710 CDS 100% 13.200 10.560 N RIN2 n/a
2 TRCN0000288966 GCAGGGATGTTCTACCATTTA pLKO_005 710 CDS 100% 13.200 10.560 N RIN2 n/a
3 TRCN0000062644 CGCATCAAGAACGATCCTTAT pLKO.1 2800 CDS 100% 10.800 8.640 N RIN2 n/a
4 TRCN0000288899 CGCATCAAGAACGATCCTTAT pLKO_005 2800 CDS 100% 10.800 8.640 N RIN2 n/a
5 TRCN0000296080 TGGCCCAGATGGGACTAAATT pLKO_005 788 CDS 100% 15.000 10.500 N RIN2 n/a
6 TRCN0000296081 ACTCGGCCAAGGGCAACTTTA pLKO_005 3004 3UTR 100% 13.200 9.240 N RIN2 n/a
7 TRCN0000296082 AGGAATCAGTTTCGCAGATTT pLKO_005 660 CDS 100% 13.200 9.240 N RIN2 n/a
8 TRCN0000062646 CCATCGCTGTTACATGGAGAA pLKO.1 2356 CDS 100% 4.050 2.835 N RIN2 n/a
9 TRCN0000062647 CCTGGTTCATAAATCTACCAA pLKO.1 534 CDS 100% 3.000 2.100 N RIN2 n/a
10 TRCN0000077542 GCCTTATAAATGGAGTGCATT pLKO.1 908 CDS 100% 4.950 2.970 N Rin2 n/a
11 TRCN0000366134 TGCAGACCATCCGGCAGTTTA pLKO_005 1838 CDS 100% 13.200 9.240 N Rin2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529258.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12040 pDONR223 100% 51.5% 51.3% None 464_1762del;1818C>T;2467G>A n/a
2 ccsbBroad304_12040 pLX_304 0% 51.5% 51.3% V5 464_1762del;1818C>T;2467G>A n/a
3 TRCN0000475994 TTCTACCCCCATTGAACAAACTGT pLX_317 23% 51.5% 51.3% V5 464_1762del;1818C>T;2467G>A n/a
Download CSV