Transcript: Human XM_011529299.3

PREDICTED: Homo sapiens kizuna centrosomal protein (KIZ), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIZ (55857)
Length:
2138
CDS:
275..2017

Additional Resources:

NCBI RefSeq record:
XM_011529299.3
NBCI Gene record:
KIZ (55857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252522 ATCAACCAGCAACAATCTTTA pLKO_005 423 CDS 100% 13.200 18.480 N Kiz n/a
2 TRCN0000423850 CCCGTTACGGGAAAGATTAAG pLKO_005 793 CDS 100% 13.200 18.480 N KIZ n/a
3 TRCN0000137214 GCTGCAGATATCCCAATCACA pLKO.1 1622 CDS 100% 3.000 4.200 N KIZ n/a
4 TRCN0000419805 CACCGATGATTCTGATGATTT pLKO_005 2072 3UTR 100% 13.200 9.240 N KIZ n/a
5 TRCN0000420121 AGTCTCTCCGATACCAGTTTC pLKO_005 922 CDS 100% 10.800 7.560 N KIZ n/a
6 TRCN0000133823 CAAGGGAACAAGAAGTTTCAA pLKO.1 1566 CDS 100% 5.625 3.938 N KIZ n/a
7 TRCN0000168010 CGAGACAAAGACAGCTAACAA pLKO.1 1774 CDS 100% 5.625 3.938 N KIZ n/a
8 TRCN0000134625 GATTGTATCAACCAGCAACAA pLKO.1 417 CDS 100% 4.950 3.465 N KIZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529299.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08600 pDONR223 100% 80.1% 77.1% None (many diffs) n/a
2 ccsbBroad304_08600 pLX_304 0% 80.1% 77.1% V5 (many diffs) n/a
3 TRCN0000480441 ATCCGCTTCCAATAACCACGCATC pLX_317 14.3% 80.1% 77.1% V5 (many diffs) n/a
Download CSV