Transcript: Human XM_011529348.3

PREDICTED: Homo sapiens synapse differentiation inducing 1 (SYNDIG1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYNDIG1 (79953)
Length:
1699
CDS:
204..1007

Additional Resources:

NCBI RefSeq record:
XM_011529348.3
NBCI Gene record:
SYNDIG1 (79953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121832 GCAAGAGGAATGGTTTAATTA pLKO.1 262 CDS 100% 15.000 10.500 N SYNDIG1 n/a
2 TRCN0000140145 GCTGGCAAGAGGAATGGTTTA pLKO.1 258 CDS 100% 10.800 7.560 N SYNDIG1 n/a
3 TRCN0000139456 GACACAGAGAGTGAGGACAAT pLKO.1 699 CDS 100% 4.950 3.465 N SYNDIG1 n/a
4 TRCN0000143320 GAGTGAGGACAATTTCCTCAT pLKO.1 707 CDS 100% 0.405 0.284 N SYNDIG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529348.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08994 pDONR223 100% 82.9% 77.5% None (many diffs) n/a
2 ccsbBroad304_08994 pLX_304 0% 82.9% 77.5% V5 (many diffs) n/a
3 TRCN0000472771 ATTAAATATTACGGAAAGGTGGGA pLX_317 64.3% 82.9% 77.5% V5 (many diffs) n/a
Download CSV