Transcript: Human XM_011529684.2

PREDICTED: Homo sapiens SAM domain, SH3 domain and nuclear localization signals 1 (SAMSN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMSN1 (64092)
Length:
1945
CDS:
194..1261

Additional Resources:

NCBI RefSeq record:
XM_011529684.2
NBCI Gene record:
SAMSN1 (64092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529684.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433427 ACACGCATTCCCAACTATATA pLKO_005 1262 CDS 100% 15.000 21.000 N SAMSN1 n/a
2 TRCN0000415756 GAGTTAATATTGGACACATTT pLKO_005 1715 3UTR 100% 13.200 18.480 N SAMSN1 n/a
3 TRCN0000133704 GAAAGGAGACATCATAGACAT pLKO.1 700 CDS 100% 4.950 6.930 N SAMSN1 n/a
4 TRCN0000138156 CAAGGGACTCTGGTTGCTATA pLKO.1 1143 CDS 100% 10.800 7.560 N SAMSN1 n/a
5 TRCN0000422110 TGCCAGAGTGCATACGGATTT pLKO_005 640 CDS 100% 10.800 7.560 N SAMSN1 n/a
6 TRCN0000136656 GCTGTTCAGATGGTACAAGTA pLKO.1 561 CDS 100% 4.950 3.465 N SAMSN1 n/a
7 TRCN0000138187 CACATGAAGGAGATCCCACAA pLKO.1 270 CDS 100% 4.050 2.835 N SAMSN1 n/a
8 TRCN0000138825 GCAGGAATACACCTCAACACT pLKO.1 904 CDS 100% 3.000 2.100 N SAMSN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529684.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03920 pDONR223 100% 95% 94.9% None 0_1ins54;2T>A n/a
2 ccsbBroad304_03920 pLX_304 0% 95% 94.9% V5 0_1ins54;2T>A n/a
3 TRCN0000472442 CGCAATTCACGTGATTGATGTCCC pLX_317 43.6% 95% 94.9% V5 0_1ins54;2T>A n/a
Download CSV