Transcript: Human XM_011529686.1

PREDICTED: Homo sapiens SAM domain, SH3 domain and nuclear localization signals 1 (SAMSN1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMSN1 (64092)
Length:
2072
CDS:
97..1026

Additional Resources:

NCBI RefSeq record:
XM_011529686.1
NBCI Gene record:
SAMSN1 (64092)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133704 GAAAGGAGACATCATAGACAT pLKO.1 657 CDS 100% 4.950 6.930 N SAMSN1 n/a
2 TRCN0000422110 TGCCAGAGTGCATACGGATTT pLKO_005 597 CDS 100% 10.800 7.560 N SAMSN1 n/a
3 TRCN0000136656 GCTGTTCAGATGGTACAAGTA pLKO.1 518 CDS 100% 4.950 3.465 N SAMSN1 n/a
4 TRCN0000138187 CACATGAAGGAGATCCCACAA pLKO.1 227 CDS 100% 4.050 2.835 N SAMSN1 n/a
5 TRCN0000138825 GCAGGAATACACCTCAACACT pLKO.1 861 CDS 100% 3.000 2.100 N SAMSN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529686.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03920 pDONR223 100% 82.7% 81.8% None 919_920ins45;922C>G;927_928ins147 n/a
2 ccsbBroad304_03920 pLX_304 0% 82.7% 81.8% V5 919_920ins45;922C>G;927_928ins147 n/a
3 TRCN0000472442 CGCAATTCACGTGATTGATGTCCC pLX_317 43.6% 82.7% 81.8% V5 919_920ins45;922C>G;927_928ins147 n/a
Download CSV